View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3656_low_25 (Length: 242)
Name: NF3656_low_25
Description: NF3656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3656_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 22 - 222
Target Start/End: Complemental strand, 11688891 - 11688691
Alignment:
| Q |
22 |
cttgtgggactgataaaaccactgctcttcattgtgctgcttcaagtggtacggttaatgctgctgatgctgtaaaattgcttttatcagctggcgctga |
121 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
11688891 |
cttgcgggactgataaaaccactgctcttcattgtgctgcttcaagtggtacggttaatgctgttgatgctgtaaaattgcttttatcagctggcgctga |
11688792 |
T |
 |
| Q |
122 |
catctattgtgtcgatgctaatgggaaccgtccaatggatgttattgttcttcctattgttgttccccataagctcgaagtggtgaaaagaagccttgaa |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
11688791 |
catctattgtgtcgatgctaatgggaaccgtccaatggatgttattgttcttcctattgttgttccccataagctcgaagtcgtgaaaagaagtcttgaa |
11688692 |
T |
 |
| Q |
222 |
c |
222 |
Q |
| |
|
| |
|
|
| T |
11688691 |
c |
11688691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 24 - 201
Target Start/End: Complemental strand, 9315310 - 9315133
Alignment:
| Q |
24 |
tgtgggactgataaaaccactgctcttcattgtgctgcttcaagtggtacggttaatgctgctgatgctgtaaaattgcttttatcagctggcgctgaca |
123 |
Q |
| |
|
||||| |||||||||| |||||||||||| |||||||| ||||||||| | |||||||||| ||||||| |||||||||||||||||||||| ||||| | |
|
|
| T |
9315310 |
tgtggaactgataaaagcactgctcttcactgtgctgcctcaagtggttcagttaatgctgttgatgctataaaattgcttttatcagctggtgctgata |
9315211 |
T |
 |
| Q |
124 |
tctattgtgtcgatgctaatgggaaccgtccaatggatgttattgttcttcctattgttgttccccataagctcgaag |
201 |
Q |
| |
|
|| ||| ||| |||||||||||||| || || |||||||||| ||| |||||||||||||||| ||||||||||||| |
|
|
| T |
9315210 |
tcaattctgtggatgctaatgggaaacgccctgtggatgttatcgttgttcctattgttgttcctcataagctcgaag |
9315133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University