View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3656_low_6 (Length: 463)
Name: NF3656_low_6
Description: NF3656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3656_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 73; Significance: 4e-33; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 314 - 390
Target Start/End: Original strand, 8389809 - 8389885
Alignment:
| Q |
314 |
acataaacctaactcggtatcaaatatgaaaataaatgaatttagtaatttctcttataatttcatttccagtatca |
390 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8389809 |
acataaacctaactcagtatcaaatatgaaaataaatgaatttagtaatttctcttataatttcatttccagtatca |
8389885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 10 - 44
Target Start/End: Original strand, 8389505 - 8389539
Alignment:
| Q |
10 |
catcatcattggagacaaaatcattggggcacaca |
44 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
8389505 |
catcatcattggagacaaaatcattggggcacaca |
8389539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University