View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3658_high_18 (Length: 250)
Name: NF3658_high_18
Description: NF3658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3658_high_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 56178291 - 56178052
Alignment:
| Q |
1 |
ttattactactactactattatatctaaatatataacnnnnnnntaacaacaaaatcatcttatatgtggtagacctacataaacatataattctgattg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
56178291 |
ttattactactactactattatatctaaatatataacaaaaaaataacaacaaaatcatcttatatgtggtagacctacatatacatataaatctgattg |
56178192 |
T |
 |
| Q |
101 |
tcttnnnnnnnnnnctaggaaattgggatatacatgatgatggagtaaccagaaccaaacaatcatttacaagtcattcctaagaaaacttcttttacac |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
56178191 |
tcttaaaaaaaatactaggaaattgggatatacatgatgatggagtaaccagaaccaaacaatcatttacaagtcattcctatgaaaacttcttttacac |
56178092 |
T |
 |
| Q |
201 |
aattacctattctttggtagaaaagaaatcagtacctatg |
240 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
56178091 |
aattacctattctttggaggaaaagaaatcagtacctatg |
56178052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University