View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3658_high_25 (Length: 237)
Name: NF3658_high_25
Description: NF3658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3658_high_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 4 - 229
Target Start/End: Complemental strand, 42637856 - 42637631
Alignment:
| Q |
4 |
caaaatcattccttcaagtccttttgcttctcaaccttccttgaattatcttcatcttcatgggtttggttatgaccatattagaaataactataagttg |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42637856 |
caaaatcattccttcaagtccttttgcttctcaaccttccttgaattatcttcatcttcatgggtttggttatgaccatattagaaataactataagttg |
42637757 |
T |
|
| Q |
104 |
attcgacatgcaataatttatcctacaacatgcaacatgggaaaaaatacttcttattctttgtgggagatatactgtctaaaaagcaactcttggagaa |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42637756 |
attcgacatgcaataatttatcctacaacatgcaacatgggaaaaaatactccttattctttgtgggagatatactgtctaaaaagcaactcttggagaa |
42637657 |
T |
|
| Q |
204 |
agcttgatgtagatatgccttcatct |
229 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
42637656 |
agcttgatgtagatatgccttcatct |
42637631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 164 - 223
Target Start/End: Complemental strand, 42629991 - 42629932
Alignment:
| Q |
164 |
ttgtgggagatatactgtctaaaaagcaactcttggagaaagcttgatgtagatatgcct |
223 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||| |||||| || |||||||| |
|
|
| T |
42629991 |
ttgtgggagatatattgtcttaaaagcaactcttggagaaaacttgatataaatatgcct |
42629932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 162 - 222
Target Start/End: Complemental strand, 9575808 - 9575748
Alignment:
| Q |
162 |
ctttgtgggagatatactgtctaaaaagcaactcttggagaaagcttgatgtagatatgcc |
222 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||| ||||||||| || ||| |||||||||| |
|
|
| T |
9575808 |
ctttgtgggagatatattgtctaaaaagtaactattggagaaaactcgatatagatatgcc |
9575748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 221
Target Start/End: Complemental strand, 16487118 - 16487064
Alignment:
| Q |
167 |
tgggagatatactgtctaaaaagcaactcttggagaaagcttgatgtagatatgc |
221 |
Q |
| |
|
||||||||||| |||||| || ||||||||||||||| |||||||| ||||||| |
|
|
| T |
16487118 |
tgggagatatatagtctaagaaacaactcttggagaaaacttgatgtcgatatgc |
16487064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 164 - 223
Target Start/End: Complemental strand, 3368212 - 3368153
Alignment:
| Q |
164 |
ttgtgggagatatactgtctaaaaagcaactcttggagaaagcttgatgtagatatgcct |
223 |
Q |
| |
|
|||||||||||||| | ||||||||| || ||||||||||| ||||| ||||||||||| |
|
|
| T |
3368212 |
ttgtgggagatatattctctaaaaaggaattcttggagaaaagttgatatagatatgcct |
3368153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 86
Target Start/End: Complemental strand, 44938324 - 44938296
Alignment:
| Q |
58 |
tcttcatgggtttggttatgaccatatta |
86 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44938324 |
tcttcatgggtttggttatgaccatatta |
44938296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University