View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3658_low_11 (Length: 309)
Name: NF3658_low_11
Description: NF3658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3658_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 40 - 246
Target Start/End: Original strand, 29776803 - 29777019
Alignment:
| Q |
40 |
agaatggagctaaatgcatgtaggagttttcaaaatatatagtcagtccttctctaacggttgagaattggttattggtgagttatctcatatctgtatt |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29776803 |
agaatggagctaaatgcatgtaggagttttcaaaatatattgtcagtccttctctaacggttgagaattggttattggtgagttatctcatatctgtatt |
29776902 |
T |
 |
| Q |
140 |
ta-----------ttaattgtgtatttgaccattgaccatgaaaattgaaatttacattctccgaatattagaaaaatcttgaatgcattcaatttcttt |
228 |
Q |
| |
|
|| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29776903 |
tattaattatgccttaattgtgtatttgaccattgaccatg-aaattgaaatttacattctccgaatattagaaaaatcttgaatgcattcaatttcttt |
29777001 |
T |
 |
| Q |
229 |
gacaacgcatgaaattga |
246 |
Q |
| |
|
|||||| ||||||||||| |
|
|
| T |
29777002 |
gacaactcatgaaattga |
29777019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 266 - 297
Target Start/End: Original strand, 29777034 - 29777065
Alignment:
| Q |
266 |
tcttcccctccctctccaacaagtcggcccta |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
29777034 |
tcttcccctccctctccaacaagtcggcccta |
29777065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University