View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3658_low_11 (Length: 309)

Name: NF3658_low_11
Description: NF3658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3658_low_11
NF3658_low_11
[»] chr8 (2 HSPs)
chr8 (40-246)||(29776803-29777019)
chr8 (266-297)||(29777034-29777065)


Alignment Details
Target: chr8 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 40 - 246
Target Start/End: Original strand, 29776803 - 29777019
Alignment:
40 agaatggagctaaatgcatgtaggagttttcaaaatatatagtcagtccttctctaacggttgagaattggttattggtgagttatctcatatctgtatt 139  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29776803 agaatggagctaaatgcatgtaggagttttcaaaatatattgtcagtccttctctaacggttgagaattggttattggtgagttatctcatatctgtatt 29776902  T
140 ta-----------ttaattgtgtatttgaccattgaccatgaaaattgaaatttacattctccgaatattagaaaaatcttgaatgcattcaatttcttt 228  Q
    ||           |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29776903 tattaattatgccttaattgtgtatttgaccattgaccatg-aaattgaaatttacattctccgaatattagaaaaatcttgaatgcattcaatttcttt 29777001  T
229 gacaacgcatgaaattga 246  Q
    |||||| |||||||||||    
29777002 gacaactcatgaaattga 29777019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 266 - 297
Target Start/End: Original strand, 29777034 - 29777065
Alignment:
266 tcttcccctccctctccaacaagtcggcccta 297  Q
    ||||||||||||||||||||||||||||||||    
29777034 tcttcccctccctctccaacaagtcggcccta 29777065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University