View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3658_low_12 (Length: 308)
Name: NF3658_low_12
Description: NF3658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3658_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 233; Significance: 1e-129; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 20 - 300
Target Start/End: Complemental strand, 42638109 - 42637829
Alignment:
| Q |
20 |
ctctcttcctacgttatgaccgatcatggtgtgacattgacgtggttagtggttacccagctgaacatgggggattgttttctctttctggagagagatt |
119 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||| ||||||| ||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42638109 |
ctctcttcctacgttacaaccgatcatggtttgacactgacgtgattagtggttacccggctagacatgggggattgttttctctttctggagagagatt |
42638010 |
T |
 |
| Q |
120 |
tgagaatagggttgaattagattggccaaatctatttcccgatgatcgaattcattttaaaatttgtggttatactagtgtcaatggcattatttgtatt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42638009 |
tgagaatagggttgaattagattggccaaatctattttccgatgatcgaattcattttaaaatttgtggttatactagtgtcaatggcattatttgtatt |
42637910 |
T |
 |
| Q |
220 |
gattataactctcaaggaagagttgtattgtggaatccagctaccaaggaaatcaaaatcattccttcaagtccctttgct |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
42637909 |
gattataactctcaaggaagagttgtattgtggaatctagctaccaaggaaaacaaaatcattccttcaagtccttttgct |
42637829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 94 - 156
Target Start/End: Original strand, 42411176 - 42411238
Alignment:
| Q |
94 |
ttgttttctctttctggagagagatttgagaatagggttgaattagattggccaaatctattt |
156 |
Q |
| |
|
|||| |||| |||| ||||||||||||||||| || || |||||||||||||||||| |||| |
|
|
| T |
42411176 |
ttgtattctgtttccggagagagatttgagaaaagagtcaaattagattggccaaatccattt |
42411238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University