View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3658_low_14 (Length: 290)
Name: NF3658_low_14
Description: NF3658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3658_low_14 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 14 - 290
Target Start/End: Original strand, 54774575 - 54774851
Alignment:
| Q |
14 |
cagagacaatggcaagcaaaccatttttaatagcaagtgaatgaacctgtctaccagtgtacacaaacacatcacttgtcaatgcacttagaacactagt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54774575 |
cagagacaatggcaagcaaaccatttttaatagcaagtgaatgaacctgtctaccagtgtacacaaacacatcacttgtcaatgcacttagaacactagt |
54774674 |
T |
 |
| Q |
114 |
gagagcaaactcattttgaatctcttcctcacgccgcataagttcaaaaacctcaaccgccttatcagcaatatcactagaagcatacccagaaatcata |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54774675 |
gagagcaaactcattttgaatctcttcctcacgccgcataagttcaaaaacctcaaccgccttatcagcaatatcactagaagcatacccagaaatcata |
54774774 |
T |
 |
| Q |
214 |
gtagcccaagaaaccgtatttctctcaggcattctgtcaaacagtttacgagcatcgcaaacaaaaccatttttaca |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
54774775 |
gtagcccaagaaaccgtatttctctcaggcattctgtcaaacagtttacgagcatcgaaaacaaaaccagttttaca |
54774851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 219 - 256
Target Start/End: Complemental strand, 30163389 - 30163352
Alignment:
| Q |
219 |
ccaagaaaccgtatttctctcaggcattctgtcaaaca |
256 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30163389 |
ccaagaaaccacatttctctcaggcattctgtcaaaca |
30163352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University