View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3658_low_22 (Length: 239)
Name: NF3658_low_22
Description: NF3658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3658_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 38335334 - 38335556
Alignment:
| Q |
1 |
ttcaactcatattttacatctttgaatactcgattttttacaaaaatctttgaatatggttatttgagtttatttatagccatatgcatttgtgagacag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38335334 |
ttcaactcatattttacatctttgaatactcgtttttttacaaaaatctttgaatatggttatttgagtttatttatagctatatgcatttgtgagacag |
38335433 |
T |
 |
| Q |
101 |
tataatttaaatatnnnnnnngattataatgtatttataggttgttttcagcttatttcaacaagttcttcaaaacaagttatgcagacaatttataata |
200 |
Q |
| |
|
|||||||| || | ||||||||||||||||||||| ||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38335434 |
tataattttaaaaaaaaataagattataatgtatttataggtcgtttttagcttatttcaacaagttcttcaagacaagttatgcagacaatttataata |
38335533 |
T |
 |
| Q |
201 |
tgcacaaatataatttaaatttt |
223 |
Q |
| |
|
| || |||||||||||||||||| |
|
|
| T |
38335534 |
tacaaaaatataatttaaatttt |
38335556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University