View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3658_low_23 (Length: 238)
Name: NF3658_low_23
Description: NF3658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3658_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 28 - 228
Target Start/End: Complemental strand, 38335187 - 38334987
Alignment:
| Q |
28 |
atgcagtatttggtttatgnnnnnnngtagacacacataaaatattggtgtgacttatttcactgaataatttaaaaaatgggtccaccaatctttattt |
127 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||| |||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
38335187 |
atgcagtatttggcttatgaaaaaaagtagacacacataaaatattggtg--acttatttcactaaataatttaaaaaatgggcccaccaatctttattt |
38335090 |
T |
 |
| Q |
128 |
atgtctatcatctatctatttaat--nnnnnnncaatttatttcttttgaggaataaacatcatctttacacctttatttcatttcatcctcaaccgcct |
225 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38335089 |
atgtctatcatctatctatttaataaaaaaaaacaatttatttcttttgaggaataaacatcatctttacacctttatttcatttcatcctcaaccgcct |
38334990 |
T |
 |
| Q |
226 |
atg |
228 |
Q |
| |
|
||| |
|
|
| T |
38334989 |
atg |
38334987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University