View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3661_high_11 (Length: 203)
Name: NF3661_high_11
Description: NF3661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3661_high_11 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 5e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 15 - 203
Target Start/End: Complemental strand, 49450982 - 49450794
Alignment:
| Q |
15 |
ggactatagaaaaaggaaagtatttgacatgcttgataaagaaaaagaatgggaagtttgatgaacatccatatgagtcagatgggtcccctgtgtttga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49450982 |
ggactatagaaaaaggaaagtatttgacatgcttgataaagaaaaagaatgggaagtttgatgaacatccatatgagtcagatgggtcccctgtgtttga |
49450883 |
T |
 |
| Q |
115 |
ttctgatgagtcatcgaacgaatccacaacaagcggtggcagttccagtagtagtagcaatagccccacagagtcaagagttagttttc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
49450882 |
ctctgatgagtcatcgaacgaatccacaacaagcggtggcagttccagtagtagtagcaatagccccacagagtcaagagttaattttc |
49450794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University