View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3664_low_9 (Length: 244)
Name: NF3664_low_9
Description: NF3664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3664_low_9 |
 |  |
|
| [»] scaffold0464 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 19721043 - 19721280
Alignment:
| Q |
1 |
aactattttgaaacctaccttttcccctatataaagacttgtaagaacaacacacatatactcgacactttgtcagtaaccaacatttgcctctcatgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
19721043 |
aactattttgaaacctaccttttcccctatataaagacttgtaagaacaacacacatatactcaacactttgtcagtaaccaacatttgcctctcatgaa |
19721142 |
T |
 |
| Q |
101 |
ttcaaacggcgatccaacttccatgctgctagtcctcttgaacgaaatcctatcagaaatcctatcacgccttcctttcaaaactttgatgcaaatgaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19721143 |
ttcaaacggcgatccaacttccatgctgctagtcctcttgaacgaaatcctatcagaaatcctatcacgccttcctttcaaaactctgatgcaaatgaaa |
19721242 |
T |
 |
| Q |
201 |
tgtgtctgcaaatcattgaaaaccctaatctctgatcc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19721243 |
tgtgtctgcaaatcattgaaaaccctaatctctgatcc |
19721280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 159 - 229
Target Start/End: Complemental strand, 19888634 - 19888564
Alignment:
| Q |
159 |
atcctatcacgccttcctttcaaaactttgatgcaaatgaaatgtgtctgcaaatcattgaaaaccctaat |
229 |
Q |
| |
|
||||| ||||| |||||| |||||||| | |||||| | |||||||| |||||||||| |||||||||||| |
|
|
| T |
19888634 |
atcctgtcacgacttcctgtcaaaactcttatgcaattcaaatgtgtttgcaaatcatggaaaaccctaat |
19888564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 154 - 239
Target Start/End: Complemental strand, 19879777 - 19879692
Alignment:
| Q |
154 |
cagaaatcctatcacgccttcctttcaaaactttgatgcaaatgaaatgtgtctgcaaatcattgaaaaccctaatctctgatcct |
239 |
Q |
| |
|
|||| ||||| ||||| |||||| |||||||| | |||||| | |||||||| |||||||| | |||||||||||| ||| ||||| |
|
|
| T |
19879777 |
cagacatcctttcacgacttcctgtcaaaactcttatgcaattcaaatgtgtttgcaaatcttggaaaaccctaatttctaatcct |
19879692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 229
Target Start/End: Original strand, 19778744 - 19778819
Alignment:
| Q |
154 |
cagaaatcctatcacgccttcctttcaaaactttgatgcaaatgaaatgtgtctgcaaatcattgaaaaccctaat |
229 |
Q |
| |
|
|||| ||||| ||||| |||||| |||||||| | |||||| | |||||||| |||||||| | |||||||||||| |
|
|
| T |
19778744 |
cagacatcctgtcacgacttcctgtcaaaactcttatgcaattcaaatgtgtttgcaaatcttggaaaaccctaat |
19778819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 54; Significance: 4e-22; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 154 - 239
Target Start/End: Complemental strand, 18909722 - 18909637
Alignment:
| Q |
154 |
cagaaatcctatcacgccttcctttcaaaactttgatgcaaatgaaatgtgtctgcaaatcattgaaaaccctaatctctgatcct |
239 |
Q |
| |
|
|||||||||| ||||| |||||| |||||||| |||||||||||||||| || ||||||||||||||||||||||| ||| ||||| |
|
|
| T |
18909722 |
cagaaatcctttcacgacttcctgtcaaaactctgatgcaaatgaaatgcgtttgcaaatcattgaaaaccctaatttctcatcct |
18909637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 154 - 239
Target Start/End: Complemental strand, 18914470 - 18914385
Alignment:
| Q |
154 |
cagaaatcctatcacgccttcctttcaaaactttgatgcaaatgaaatgtgtctgcaaatcattgaaaaccctaatctctgatcct |
239 |
Q |
| |
|
|||||||||| || || |||||| |||||||| |||||||||||||||| || ||||||||||||||||||||||| ||| ||||| |
|
|
| T |
18914470 |
cagaaatcctttctcgacttcctgtcaaaactctgatgcaaatgaaatgcgtttgcaaatcattgaaaaccctaatttctcatcct |
18914385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 154 - 239
Target Start/End: Complemental strand, 18921618 - 18921533
Alignment:
| Q |
154 |
cagaaatcctatcacgccttcctttcaaaactttgatgcaaatgaaatgtgtctgcaaatcattgaaaaccctaatctctgatcct |
239 |
Q |
| |
|
|||||||||| ||||| ||||| | |||||| |||||||||||||||| || ||||||||||||||||||||||| ||| ||||| |
|
|
| T |
18921618 |
cagaaatcctttcacgtcttccagtaaaaactctgatgcaaatgaaatgcgtttgcaaatcattgaaaaccctaatttctcatcct |
18921533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 196 - 239
Target Start/End: Complemental strand, 20579001 - 20578958
Alignment:
| Q |
196 |
tgaaatgtgtctgcaaatcattgaaaaccctaatctctgatcct |
239 |
Q |
| |
|
||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
20579001 |
tgaaacgtgtttgcaaatcatggaaaaccctaatctctgatcct |
20578958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 156 - 236
Target Start/End: Complemental strand, 32579788 - 32579708
Alignment:
| Q |
156 |
gaaatcctatcacgccttcctttcaaaactttgatgcaaatgaaatgtgtctgcaaatcattgaaaaccctaatctctgat |
236 |
Q |
| |
|
||||||||||||||||||||| |||||||| | |||||| | |||||||| |||||||||| |||||||||||| |||||| |
|
|
| T |
32579788 |
gaaatcctatcacgccttcctgtcaaaactcttatgcaattcaaatgtgtttgcaaatcatggaaaaccctaatttctgat |
32579708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 155 - 233
Target Start/End: Complemental strand, 12735747 - 12735669
Alignment:
| Q |
155 |
agaaatcctatcacgccttcctttcaaaactttgatgcaaatgaaatgtgtctgcaaatcattgaaaaccctaatctct |
233 |
Q |
| |
|
|||||| || ||||| |||||| ||||||||||||||||| | |||||||| |||||||||| |||||||||||||||| |
|
|
| T |
12735747 |
agaaattctttcacgacttcctgtcaaaactttgatgcaattcaaatgtgtttgcaaatcatggaaaaccctaatctct |
12735669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0464 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: scaffold0464
Description:
Target: scaffold0464; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 155 - 233
Target Start/End: Original strand, 7183 - 7261
Alignment:
| Q |
155 |
agaaatcctatcacgccttcctttcaaaactttgatgcaaatgaaatgtgtctgcaaatcattgaaaaccctaatctct |
233 |
Q |
| |
|
|||||| || ||||| |||||| |||||||| |||||||| | ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7183 |
agaaattctttcacgacttcctgtcaaaactctgatgcaattcaaatgtgtctgcaaatcatggaaaaccctaatctct |
7261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 198 - 240
Target Start/End: Original strand, 42693671 - 42693713
Alignment:
| Q |
198 |
aaatgtgtctgcaaatcattgaaaaccctaatctctgatcctc |
240 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
42693671 |
aaatgtgtctgcaaatcatggaaaactctaatctctgatcctc |
42693713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 165 - 229
Target Start/End: Original strand, 14748550 - 14748614
Alignment:
| Q |
165 |
tcacgccttcctttcaaaactttgatgcaaatgaaatgtgtctgcaaatcattgaaaaccctaat |
229 |
Q |
| |
|
||||| || ||| |||||||| | |||||| | |||||||| |||||||||| |||||||||||| |
|
|
| T |
14748550 |
tcacgactccctgtcaaaactcttatgcaattcaaatgtgtttgcaaatcatggaaaaccctaat |
14748614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University