View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3665_low_10 (Length: 231)

Name: NF3665_low_10
Description: NF3665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3665_low_10
NF3665_low_10
[»] chr4 (1 HSPs)
chr4 (13-215)||(31069668-31069881)


Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 13 - 215
Target Start/End: Complemental strand, 31069881 - 31069668
Alignment:
13 catagggaaaactgaacggtgagattcaacattttgcaaatca-------tatcaaatgtagcatgtggtttattatcattacaaggaaaaatgagcttg 105  Q
    |||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||    
31069881 catagggaaaactgaacggtgagattcaacattttgcaaatcaagttttgtatcaaatgtagcatgtggtttattatcattacaaggaaaaatgagcttg 31069782  T
106 aaaaccgtggtttggatcattcaaatgaacaccaatacgattttcaaagaagaacgtgacatgca----ttaacatattaaaagaacgtacggtaggata 201  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    |||||||||||||||||||||||||||||||    
31069781 aaaaccgtggtttggatcattcaaatgaacaccaatacgattttcaaacaagaacgtgacatgcattaattaacatattaaaagaacgtacggtaggata 31069682  T
202 taaaaacacattaa 215  Q
    ||||||||||||||    
31069681 taaaaacacattaa 31069668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University