View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3665_low_3 (Length: 329)
Name: NF3665_low_3
Description: NF3665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3665_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 74 - 313
Target Start/End: Original strand, 10202718 - 10202957
Alignment:
| Q |
74 |
cgaacggttgttgctgtcatgagtgtttcgggtttggtgttgggtgggaggtcggagagggtgaccggaggaaggaagacgtgggaaatgccatgaggta |
173 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10202718 |
cgaacggtggtggctgtcatgagtgtttcgggtttggtgttgggtgggaggtcggagagggtgatcggaggaaggaagacgtgggaaatgccatgaggta |
10202817 |
T |
 |
| Q |
174 |
gggaggtgagtacggtggtttgagcctttgaaggtggaccgtcgttggggatgatgaaggtgatgggaaggttatgtttggagagtctcttggcgaattc |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10202818 |
gggaggtgagtacggtggtttgagcctttgaaggtggaccgtcgttggggatgatgaaggtgatgggaaggttatgtttggagagtctcttggcgaattc |
10202917 |
T |
 |
| Q |
274 |
gaccattggaatgagatgtcccattcctggagttggaaac |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10202918 |
gaccattggaatgagatgtcccattcctggagttggaaac |
10202957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 90 - 313
Target Start/End: Original strand, 10209807 - 10210030
Alignment:
| Q |
90 |
tcatgagtgtttcgggtttggtgttgggtgggaggtcggagagggtgaccggaggaaggaagacgtgggaaatgccatgaggtagggaggtgagtacggt |
189 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10209807 |
tcatgagtggttcaggtttggtgttgggtgggaggtcggagagggtgaccggagggaggaagacgtgggaaatgccatgaggtagggaggtgagtacggt |
10209906 |
T |
 |
| Q |
190 |
ggtttgagcctttgaaggtggaccgtcgttggggatgatgaaggtgatgggaaggttatgtttggagagtctcttggcgaattcgaccattggaatgaga |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10209907 |
tgtttgagcctttgaaggtggaccgtcgttggggatgatgaaggtgatgggaaggttatgtttggagagtctcttggcgaattcgaccattggaatgaga |
10210006 |
T |
 |
| Q |
290 |
tgtcccattcctggagttggaaac |
313 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
10210007 |
tgtcccattcctggagttggaaac |
10210030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University