View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3666_high_5 (Length: 236)

Name: NF3666_high_5
Description: NF3666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3666_high_5
NF3666_high_5
[»] chr5 (1 HSPs)
chr5 (1-220)||(38054738-38054956)


Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 38054956 - 38054738
Alignment:
1 tataggaataaacatgtaaaactaccacatacatttgagataaatttatcccccctctaattttttgctactaccgattgtttttgctacagattcatgt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
38054956 tataggaataaacatgtaaaactaccacatacatttgagataaatttatccccc-tctaattttttgctactaccgattgtttttgctacagattcatgt 38054858  T
101 actaaagaaccaaggagaacaatatttagcagtgaaaaaattgaataattaatagaaaaaagaagtatatgaagataaactaaccaaatattcataaaat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38054857 actaaagaaccaaggagaacaatatttagcagtgaaaaaattgaataattaatagaaaaaagaagtatatgaagataaactaaccaaatattcataaaat 38054758  T
201 aatggttcataggaacaatt 220  Q
    ||||||||||| ||||||||    
38054757 aatggttcatacgaacaatt 38054738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University