View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3667_low_3 (Length: 259)
Name: NF3667_low_3
Description: NF3667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3667_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 4 - 169
Target Start/End: Complemental strand, 32327181 - 32327017
Alignment:
| Q |
4 |
cgaagaatatgacattagaacgtggttttgcagttgtcgtggtttctatagatccaaacacaccataagaaaatgtacattaataattgctacatgattg |
103 |
Q |
| |
|
|||| ||||||||||||||| | ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32327181 |
cgaaaaatatgacattagaatgcggttttgcagttgtcgtggtttcta--gatccaaacacaccataagaaaatgtacattaataattgctacatgattg |
32327084 |
T |
|
| Q |
104 |
tccttaccagtgtattactggaaacggatcccctcctatgaaattttcac-ttgagggagtgcagtg |
169 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
32327083 |
tccttacctgtgtattactggaaacggatcccctcctatgaaattttcactttgtgggagtgcagtg |
32327017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 192 - 241
Target Start/End: Complemental strand, 32322319 - 32322270
Alignment:
| Q |
192 |
tgtgtacattcggtcgtgggaaaaaagtagctcggatttcactgggttct |
241 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32322319 |
tgtgtacgttcggtcgtgggaaacaagtagctcggatttcactgggttct |
32322270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University