View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3668_high_8 (Length: 314)
Name: NF3668_high_8
Description: NF3668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3668_high_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 11 - 220
Target Start/End: Complemental strand, 16045698 - 16045488
Alignment:
| Q |
11 |
caaaggactaacataatttacactatatctttcagcaactaatttaacttttt-attcactgcaatatatttactcacgctgatatagctgcattccaag |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16045698 |
caaaggactaacataatttacactatatctttcagcaactaatttaacttttttattcactgcaatatatttactcacgctgatatagctgcattccaag |
16045599 |
T |
|
| Q |
110 |
tgataaaatctctactcggcacggcatcaaatatccttctagccgaaaccaactcaccacacttactatacatactaatcaaagccgaaccaatatacga |
209 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
16045598 |
tgataaaatctctactcggcatgccatcaaatatccttctagacgaaaccaactcaccacacttactatacatactaatcaaagcagaaccaatatacga |
16045499 |
T |
|
| Q |
210 |
attaaccttca |
220 |
Q |
| |
|
||||||||||| |
|
|
| T |
16045498 |
attaaccttca |
16045488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University