View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3669_high_16 (Length: 242)
Name: NF3669_high_16
Description: NF3669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3669_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 119 - 240
Target Start/End: Complemental strand, 49156785 - 49156664
Alignment:
| Q |
119 |
ctttttcattttgcaataacgctatatattgtgtcactactctctcacttcacaaaccctagcatcttcattctctttctctctcatcgaagatggcttc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49156785 |
ctttttcattttgcaataacgctatatagtgtgtcactactctctcacttcacaaaccctagcatcttcattctctttctctctcatcgaagatggcttc |
49156686 |
T |
 |
| Q |
219 |
acgcagattggtatcatctctg |
240 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
49156685 |
acgcagattggtatcatctctg |
49156664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 49156904 - 49156861
Alignment:
| Q |
1 |
aattattattcattatta-catattaaattaaatttcacggtgt |
43 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
49156904 |
aattattattcattattaacatattaaattaaatttcacggtgt |
49156861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 197 - 233
Target Start/End: Complemental strand, 39266455 - 39266419
Alignment:
| Q |
197 |
ctctctcatcgaagatggcttcacgcagattggtatc |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39266455 |
ctctctcatcgaagatggcttcacgcagattggtatc |
39266419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University