View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3669_high_16 (Length: 242)

Name: NF3669_high_16
Description: NF3669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3669_high_16
NF3669_high_16
[»] chr1 (2 HSPs)
chr1 (119-240)||(49156664-49156785)
chr1 (1-43)||(49156861-49156904)
[»] chr7 (1 HSPs)
chr7 (197-233)||(39266419-39266455)


Alignment Details
Target: chr1 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 119 - 240
Target Start/End: Complemental strand, 49156785 - 49156664
Alignment:
119 ctttttcattttgcaataacgctatatattgtgtcactactctctcacttcacaaaccctagcatcttcattctctttctctctcatcgaagatggcttc 218  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49156785 ctttttcattttgcaataacgctatatagtgtgtcactactctctcacttcacaaaccctagcatcttcattctctttctctctcatcgaagatggcttc 49156686  T
219 acgcagattggtatcatctctg 240  Q
    ||||||||||||||||||||||    
49156685 acgcagattggtatcatctctg 49156664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 49156904 - 49156861
Alignment:
1 aattattattcattatta-catattaaattaaatttcacggtgt 43  Q
    |||||||||||||||||| |||||||||||||||||||||||||    
49156904 aattattattcattattaacatattaaattaaatttcacggtgt 49156861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 197 - 233
Target Start/End: Complemental strand, 39266455 - 39266419
Alignment:
197 ctctctcatcgaagatggcttcacgcagattggtatc 233  Q
    |||||||||||||||||||||||||||||||||||||    
39266455 ctctctcatcgaagatggcttcacgcagattggtatc 39266419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University