View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3669_high_2 (Length: 532)
Name: NF3669_high_2
Description: NF3669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3669_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 271 - 520
Target Start/End: Complemental strand, 6486616 - 6486367
Alignment:
| Q |
271 |
gttcgatgacccttagctcactagacgagctatttggattctttgcatgaacatggtgcagttcgctgcagaaccatttgatgtaaactgaatttgagtt |
370 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6486616 |
gttcgatgacccttagctcactagacgagctatttggattctttgcatgtacatggtgcagttcgctgcagaaccgtttgatgtaaactgaatttgagtt |
6486517 |
T |
 |
| Q |
371 |
cacaaacggctctgcaatgtgctgcaccatacagagaatccaaatctaaataaaatgttattgtatcctaaaattaatcgttgctaacttataattaatt |
470 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6486516 |
cacaaacggctctgcaatgtgctgcaccatacagagaatccaaatctaaataaaatgttattgtatcctaaaattaatcgttgctaacttataattaatt |
6486417 |
T |
 |
| Q |
471 |
tgaaatttggaattcagattaagtggtgagggctcaccaatgatgatgtc |
520 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6486416 |
tgaaatttggaattcagattaagtggtgagggctcaccaatgatgatgtc |
6486367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 157; E-Value: 3e-83
Query Start/End: Original strand, 50 - 210
Target Start/End: Complemental strand, 6486838 - 6486678
Alignment:
| Q |
50 |
cagcagcaacaacaataataacattcctcgtccacagtttatgcaatccgaaccccgattttccacaacagaagcctatactgacgatgactatgccatg |
149 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6486838 |
cagcagcaacaacaacaataacattcctcgtccacagtttatgcaatccgaaccccgattttccacaacagaagcctatactgacgatgactatgccatg |
6486739 |
T |
 |
| Q |
150 |
cgtagcagcagcgccgcctcccccatgagcccttactactacgaccctggaaggtctctcc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6486738 |
cgtagcagcagcgccgcctcccccatgagcccttactactacgaccctggaaggtctctcc |
6486678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University