View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3669_low_12 (Length: 279)
Name: NF3669_low_12
Description: NF3669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3669_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 10 - 166
Target Start/End: Complemental strand, 36129458 - 36129302
Alignment:
| Q |
10 |
gcagagacaaaacagagaaatagatagatagagagaagggtagagggttttgtaaagttgctttgcttgtatatcattttgctcatttaatttacagtga |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36129458 |
gcagagacaaaacagagaaatagatagatagagagaagggtagagggttttgtaaagttgctttgcttgtatatcattttgctcatttaatttacagtga |
36129359 |
T |
 |
| Q |
110 |
gcataggaattgaattgaagagttagtgtaaagttgagagcgtattctttagtcttt |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36129358 |
gcataggaattgaattgaagagttagtgtaaagttgagagcgtattctttagtcttt |
36129302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 193 - 262
Target Start/End: Complemental strand, 36129271 - 36129202
Alignment:
| Q |
193 |
tgtatgatggagtccctgaccaattccaccaattcataactccaagaacttcttcatcatcactacctct |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36129271 |
tgtatgatggagtccctgaccaattccaccaattcataactccaagaacttcttcatcatcactacctct |
36129202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University