View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3669_low_13 (Length: 254)
Name: NF3669_low_13
Description: NF3669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3669_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 34747293 - 34747540
Alignment:
| Q |
1 |
tcaaattactttgtttgagtgagtcttctttctcatgaagggcatgagtgagcaagcatggctgtgctaaattgtagtacttggttaatttgaagattct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34747293 |
tcaaattactttgtttgagtgagtcttctttctcatgaaggacatgagtgagcaagcatggctgtgctaaattgtagtacttggttaatttgaagattct |
34747392 |
T |
 |
| Q |
101 |
tgtatgcannnnnnnnnnn-ctttctgtagtacttgtatgaatatttctatttttt-gttgctttggaaatgagcatattgctagttctatttgtcaagt |
198 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34747393 |
tgtatgcatgttttttttttctttctgtagtacttgtatgaatatttctatttttttgttgttttggaaatgagcatattgctatttctatttgtcaagt |
34747492 |
T |
 |
| Q |
199 |
ctccattttcttttgtttgtttagtttaatcttcatcctgtctctgct |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34747493 |
ctccattttcttttgtttgtttagtttaatcttcatcctatctctgct |
34747540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University