View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3669_low_18 (Length: 237)
Name: NF3669_low_18
Description: NF3669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3669_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 33958749 - 33958518
Alignment:
| Q |
1 |
ctcaccacacagctcataaagttcaaaaggttattgtgctgactttctgggtagnnnnnnnnnnnnnnnnnnnnncccgttaaaacacattttctatgtg |
100 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
33958749 |
ctcaccacacagctcctaaaattcaaaaggttattgtgctgactttctgggtagttttcttttattttttattttcccgttaaaacacattttctgtgtg |
33958650 |
T |
|
| Q |
101 |
tagattttccacttattcagttatcactattagaagaaatgaggaccacacaaacaaat-----------aggaagagcttcgctaagtagaaaagttcc |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| |
|
|
| T |
33958649 |
tagattttccacttattcagttatcactattagaagaaatgaggaccacacaaacaaatattattgggagaggaagagcttcgctaagtagaaaaggtcc |
33958550 |
T |
|
| Q |
190 |
cctcatcatgaatatccttggctatgaaacaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
33958549 |
cctcatcatgaatatccttggctatgaaacaa |
33958518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University