View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3669_low_9 (Length: 335)
Name: NF3669_low_9
Description: NF3669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3669_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 21 - 322
Target Start/End: Complemental strand, 3609372 - 3609071
Alignment:
| Q |
21 |
gtcttttgatcaatataattttttatgtatcttactttcacttgatttataaagctcnnnnnnncttcttatgctcaaaatcttaatatggtatcagagc |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3609372 |
gtcttttgatcaatataattttttatgtatcttactttcacttgatttataaagctctttttttcttcttatgctcaaaattttaatatggtatcagagc |
3609273 |
T |
 |
| Q |
121 |
ttggttgtgatcttcacgatgccgctatttcactgcgatttttcgagtgatcattgatccaccaacctttctcatggcctatgccattctctgccattta |
220 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3609272 |
ctggttgtgatcttcatgatgccgttatttcactgtgatttttcgagtgatcattgatccaccaacctttctcatggcctatgccattctctgccattta |
3609173 |
T |
 |
| Q |
221 |
tggaagccttcaaaagtggaaaggaaattcacacctctgtcacttcttccatccactctcaaaaacaagaataagattaatgataaaaacgtgtttttag |
320 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3609172 |
tggaagccttcaaaagtggaaaggaaattcacacctctgtcacttcttccatccactctcaaaaacaagaataagattaatgataaaaacgtgcttttag |
3609073 |
T |
 |
| Q |
321 |
tg |
322 |
Q |
| |
|
|| |
|
|
| T |
3609072 |
tg |
3609071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 174 - 242
Target Start/End: Complemental strand, 39219773 - 39219705
Alignment:
| Q |
174 |
ttgatccaccaacctttctcatggcctatgccattctctgccatttatggaagccttcaaaagtggaaa |
242 |
Q |
| |
|
|||||||||||| ||| ||| ||||||| ||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
39219773 |
ttgatccaccaagatttatcacggcctattccattctctgccatttatggaagatttcaaaaatggaaa |
39219705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 16 - 73
Target Start/End: Complemental strand, 36572294 - 36572237
Alignment:
| Q |
16 |
tcactgtcttttgatcaatataattttttatgtatcttactttcacttgatttataaa |
73 |
Q |
| |
|
||||| ||||||||||||||||||||| || || |||||||||||||| ||||||| |
|
|
| T |
36572294 |
tcactatcttttgatcaatataattttcaataaattttactttcacttgagttataaa |
36572237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University