View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3670_high_2 (Length: 337)
Name: NF3670_high_2
Description: NF3670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3670_high_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 259; Significance: 1e-144; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 321
Target Start/End: Original strand, 39535561 - 39535876
Alignment:
| Q |
1 |
ccctccacgtcactggcctttgcggagacactcacgtccaagcgctttttacccacccctccacttcctctgcagacatcaccttggaatgtagcgcata |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39535561 |
ccctccacgtcactggcctatgcggagacactcacgtccaagcgctttttacccacccctccacttcctctgcagacatcaccttggaatgtagcgcata |
39535660 |
T |
|
| Q |
101 |
ccagcagacacagaatggtggtactggtagtaggattggaactatttacattttctttttaggctatggataattatgaattaatgatgatgatatagtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39535661 |
ccagcagacacagaatggtggtactggtagtaggattggaactatttacattttctttttaggctatggataattatgaattaatgatgatgatatagtt |
39535760 |
T |
|
| Q |
201 |
ggagttttatttgattctcattttggttgcacgtgcaaacacatgatgtattgagttagatagatattatttatccaactttgagnnnnnnnccccattt |
300 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||| ||| |
|
|
| T |
39535761 |
ggagttttattttattctcattttggtttcacgtgcaaacacatgatgtattgagt----tagatattatttatccaactttgagttttttt-ccctttt |
39535855 |
T |
|
| Q |
301 |
atttgccgcattattttgttc |
321 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
39535856 |
atttgccgcattattttgttc |
39535876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 1 - 103
Target Start/End: Complemental strand, 39519847 - 39519745
Alignment:
| Q |
1 |
ccctccacgtcactggcctttgcggagacactcacgtccaagcgctttttacccacccctccacttcctctgcagacatcaccttggaatgtagcgcata |
100 |
Q |
| |
|
||||||| || |||||| | ||||||||||||||||| |||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
39519847 |
ccctccatgttactggcttatgcggagacactcacgttcaagcgctttttgcccacccctccacttcctctatagacatcaccttggaatgtagcgcata |
39519748 |
T |
|
| Q |
101 |
cca |
103 |
Q |
| |
|
||| |
|
|
| T |
39519747 |
cca |
39519745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University