View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3670_low_4 (Length: 329)
Name: NF3670_low_4
Description: NF3670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3670_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 16 - 223
Target Start/End: Original strand, 41795603 - 41795810
Alignment:
| Q |
16 |
tcatcttcctttcagggtctagctttatttcttcttggaaactcttctccagtgaatcaatctggttacttgttaatctcttcttcttctctctataatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41795603 |
tcatcttcctttcagggtctagctttatttcttcttggaaactcttctccagtgaatcaatctggttacttgttaatctcttcttcttctctctataatt |
41795702 |
T |
 |
| Q |
116 |
atttccatcaatgttcatttcatccatagctggaagtaacctttgttgtgtctcacccaatgacggttgactcatttccattcctaattttccaacatat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41795703 |
atttccatcaatgttcatttcatccatagctggaagtaacctttgttgtgtctcacccaatgacggttgactcatttccattcctaattttccaacatac |
41795802 |
T |
 |
| Q |
216 |
accaatga |
223 |
Q |
| |
|
|||||||| |
|
|
| T |
41795803 |
accaatga |
41795810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 316
Target Start/End: Original strand, 41795846 - 41795886
Alignment:
| Q |
276 |
atgaaatacttaatctatgccttcatttctttgtacaccct |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41795846 |
atgaaatacttaatctatgccttcatttctttgtacaccct |
41795886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University