View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3671_high_3 (Length: 375)
Name: NF3671_high_3
Description: NF3671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3671_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 21 - 368
Target Start/End: Original strand, 43775381 - 43775729
Alignment:
| Q |
21 |
cctgcagaggctgataagttgttgaaaatctagagggagttggacgaaacaaaaatcatccttgtaagtgtttagcatgcatgacattgtattgcaacgc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43775381 |
cctgcagaggctgataagttgttgaaaatccagagggagttggacgaaacaaaaatcatccttgtaagtgtttagcatgcatggcattgtattgcaacgc |
43775480 |
T |
|
| Q |
121 |
agtatgtgagttccctgcatcttttgtcttctaaatttacttaagttaacaatgatatgcttggtagttttctaaatgaaaattttgtttgtttgagatt |
220 |
Q |
| |
|
|| || || |||||||||||||||||||||||||||||||||||||||||||| ||||| || ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43775481 |
agcatatgggttccctgcatcttttgtcttctaaatttacttaagttaacaattatatgattagtaattttctaaatgaaaattttgtttgtttgagatt |
43775580 |
T |
|
| Q |
221 |
cggcattggtttccaaatagatatatttttagatgaaaatgtcagtgttatgcaacccaagcatcattcaacagccaaatataacgtactattgcaaatt |
320 |
Q |
| |
|
||||||||||| |||| |||||||| |||||| ||||||| |||| | |||||||||||||||| | | ||| |||||||| | |||||| |||||| |
|
|
| T |
43775581 |
tggcattggttttcaaacagatatatctttagacgaaaatgccagtatcatgcaacccaagcatccctgcagagcaaaatataatgcactattacaaatt |
43775680 |
T |
|
| Q |
321 |
tatcc-tttcatagctccgtgatgtgatgccgtagattttgatgatgtc |
368 |
Q |
| |
|
||||| ||||||||| |||||||||||| ||||||| | |||||||| |
|
|
| T |
43775681 |
tatccatttcatagcatcgtgatgtgatgtagtagattctaatgatgtc |
43775729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University