View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3671_low_4 (Length: 315)
Name: NF3671_low_4
Description: NF3671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3671_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 101; Significance: 5e-50; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 2 - 118
Target Start/End: Original strand, 7501960 - 7502076
Alignment:
| Q |
2 |
gtggagtagcataggaacggtgagaattagtatgatggtgaagggaagtgaacgcatcggagaagaatgaattgtaaccaccggggaaagtggagatgac |
101 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7501960 |
gtggaggaggataggaacggtgagaattagtatgatggtgaagggaagggaacgcatcggagaagaatgaactgtaaccaccggggaaagtggagatgac |
7502059 |
T |
 |
| Q |
102 |
atcgttaacgattggat |
118 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
7502060 |
atcgttaacgattggat |
7502076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 134 - 222
Target Start/End: Original strand, 7510905 - 7510993
Alignment:
| Q |
134 |
caaactttcttcttctcattacttgctaccggtttaattatttattgttaatattatttggattttaacttaaaaaatgttcttttatt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7510905 |
caaactttcttcttctcattacttgctaccggtttaattatttattgttaatattatttggattttaacttaaaaaatgttcttttatt |
7510993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 250 - 299
Target Start/End: Original strand, 7511020 - 7511070
Alignment:
| Q |
250 |
ttccttttcctgcgcacttcaattttaagaccaa-tgcaatgggtagttga |
299 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||| |||||||| ||||||| |
|
|
| T |
7511020 |
ttcctcttcctgcgcacttcaactttaagaccaagtgcaatggatagttga |
7511070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 57; Significance: 8e-24; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 143 - 210
Target Start/End: Complemental strand, 40670140 - 40670072
Alignment:
| Q |
143 |
ttcttctcatta-cttgctaccggtttaattatttattgttaatattatttggattttaacttaaaaaa |
210 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40670140 |
ttcttctcattaacttgctaccgatttaattatttattgttaatattatttggattttaacttaaaaaa |
40670072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 12 - 101
Target Start/End: Complemental strand, 27241001 - 27240912
Alignment:
| Q |
12 |
ataggaacggtgagaattagtatgatggtgaagggaagtgaacgcatcggagaagaatgaattgtaaccaccggggaaagtggagatgac |
101 |
Q |
| |
|
|||||||| ||||||||| || ||||||| ||||||| ||| || |||||||| || ||| ||||||||| ||||||||||||||||| |
|
|
| T |
27241001 |
ataggaacaatgagaattattaagatggtgcagggaagggaatgcgtcggagaaaaaggaacggtaaccaccagggaaagtggagatgac |
27240912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 60 - 101
Target Start/End: Complemental strand, 27246482 - 27246441
Alignment:
| Q |
60 |
ggagaagaatgaattgtaaccaccggggaaagtggagatgac |
101 |
Q |
| |
|
||||||||| |||| ||||||||| ||||||||||||||||| |
|
|
| T |
27246482 |
ggagaagaaggaatggtaaccaccagggaaagtggagatgac |
27246441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University