View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3672_high_5 (Length: 233)
Name: NF3672_high_5
Description: NF3672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3672_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 21 - 218
Target Start/End: Complemental strand, 43017252 - 43017059
Alignment:
| Q |
21 |
taaagagtagtggaacgaggatttcaaggtgataaggtcaatgttgttttggtagacctccccaatcatatatttaatcatcggaagtattaattagtcc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43017252 |
taaagagtagtggaacgaggatttcaaggtgataaggtcaatgttgttttggtagacctccccaatcatatatttaatcatcggaagtatta----gtcc |
43017157 |
T |
 |
| Q |
121 |
atgttttgtttcacatttagaggagatgaactcgattatgcaggtgtagaattaattgtttcaacatgttagtgtctttgttgtgtccgttgtctgtg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43017156 |
atgttttgtttcacatttagaggagatgaactcgattatgcaggtgtagaattaattgtttcaacatgttagtgtctttgttgtgtccgttgtctgtg |
43017059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University