View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3673_high_5 (Length: 262)
Name: NF3673_high_5
Description: NF3673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3673_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 1e-62; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 12 - 141
Target Start/End: Original strand, 36618666 - 36618795
Alignment:
| Q |
12 |
cagagaggagagtgatgagagtgatgtgattgggttcgacttcggcttcgagcatttggatgaattcggaagatgctttgaggaaattgttatttttgca |
111 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36618666 |
cagagaggagagtgatgagggtgatgtgattgggttcgacttcggcttcgagcatttggatgaattcggaagctgctttgaggaaattgttatttttgca |
36618765 |
T |
|
| Q |
112 |
gtggtgagaaattgaggatgtccatgatac |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
36618766 |
gtggtgagaaattgaggatgtccatgatac |
36618795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 12 - 141
Target Start/End: Original strand, 36652419 - 36652548
Alignment:
| Q |
12 |
cagagaggagagtgatgagagtgatgtgattgggttcgacttcggcttcgagcatttggatgaattcggaagatgctttgaggaaattgttatttttgca |
111 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36652419 |
cagagaggagagtgatgagggtgatgtgattgggttcgacttcggcttcgagcatttggatgaattcggaagctgctttgaggaaattgttatttttgca |
36652518 |
T |
|
| Q |
112 |
gtggtgagaaattgaggatgtccatgatac |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
36652519 |
gtggtgagaaattgaggatgtccatgatac |
36652548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 208 - 247
Target Start/End: Original strand, 36618862 - 36618901
Alignment:
| Q |
208 |
agaaaatgtagagggagggtgaatttgtggaggttgtttt |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36618862 |
agaaaatgtagagggagggtgaatttgtggaggttgtttt |
36618901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 208 - 247
Target Start/End: Original strand, 36652615 - 36652654
Alignment:
| Q |
208 |
agaaaatgtagagggagggtgaatttgtggaggttgtttt |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36652615 |
agaaaatgtagagggagggtgaatttgtggaggttgtttt |
36652654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University