View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3673_high_5 (Length: 262)

Name: NF3673_high_5
Description: NF3673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3673_high_5
NF3673_high_5
[»] chr2 (4 HSPs)
chr2 (12-141)||(36618666-36618795)
chr2 (12-141)||(36652419-36652548)
chr2 (208-247)||(36618862-36618901)
chr2 (208-247)||(36652615-36652654)


Alignment Details
Target: chr2 (Bit Score: 122; Significance: 1e-62; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 12 - 141
Target Start/End: Original strand, 36618666 - 36618795
Alignment:
12 cagagaggagagtgatgagagtgatgtgattgggttcgacttcggcttcgagcatttggatgaattcggaagatgctttgaggaaattgttatttttgca 111  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
36618666 cagagaggagagtgatgagggtgatgtgattgggttcgacttcggcttcgagcatttggatgaattcggaagctgctttgaggaaattgttatttttgca 36618765  T
112 gtggtgagaaattgaggatgtccatgatac 141  Q
    ||||||||||||||||||||||||||||||    
36618766 gtggtgagaaattgaggatgtccatgatac 36618795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 12 - 141
Target Start/End: Original strand, 36652419 - 36652548
Alignment:
12 cagagaggagagtgatgagagtgatgtgattgggttcgacttcggcttcgagcatttggatgaattcggaagatgctttgaggaaattgttatttttgca 111  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
36652419 cagagaggagagtgatgagggtgatgtgattgggttcgacttcggcttcgagcatttggatgaattcggaagctgctttgaggaaattgttatttttgca 36652518  T
112 gtggtgagaaattgaggatgtccatgatac 141  Q
    ||||||||||||||||||||||||||||||    
36652519 gtggtgagaaattgaggatgtccatgatac 36652548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 208 - 247
Target Start/End: Original strand, 36618862 - 36618901
Alignment:
208 agaaaatgtagagggagggtgaatttgtggaggttgtttt 247  Q
    ||||||||||||||||||||||||||||||||||||||||    
36618862 agaaaatgtagagggagggtgaatttgtggaggttgtttt 36618901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 208 - 247
Target Start/End: Original strand, 36652615 - 36652654
Alignment:
208 agaaaatgtagagggagggtgaatttgtggaggttgtttt 247  Q
    ||||||||||||||||||||||||||||||||||||||||    
36652615 agaaaatgtagagggagggtgaatttgtggaggttgtttt 36652654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University