View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3673_low_7 (Length: 248)
Name: NF3673_low_7
Description: NF3673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3673_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 36742007 - 36742230
Alignment:
| Q |
1 |
ttttagcataaggcggcatgctgtcaatctcacatattcaacaatgttcgaatatgcagatttataaatatgcagtttgaatttctaatgttcagaatta |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36742007 |
ttttagcataaggtggcatgctgtcaatctcacatattcaacaatgttcgaatatgcagatttataaatatgcagtttgaatttctaatgttcagaatta |
36742106 |
T |
|
| Q |
101 |
tcaataagttaacagaagtttgccagggacatgttttaacgagaacgagtttgcatcaatactcatcatcatgtgattgattccattttggtatttgata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36742107 |
tcaataagttaacagaagtttgccagggacaagttttaacgagaacgagtttgcatcaatactcatcatcatgtgattgattccattttggtatttgata |
36742206 |
T |
|
| Q |
201 |
gtacctgatcagatgatgacatca |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
36742207 |
gtacctgatcagatgatgacatca |
36742230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University