View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3675_high_11 (Length: 306)
Name: NF3675_high_11
Description: NF3675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3675_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 12 - 287
Target Start/End: Complemental strand, 39365584 - 39365300
Alignment:
| Q |
12 |
acagagatgagggtgcacatggattgccctggatgtgaaaacaaagtgaaaactgcacttcagaaaatgaaaggtacctt---------attttgtacat |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39365584 |
acagagatgagggtgcacatggattgccctggatgtgaaaacaaagtgaaaactgcacttcagaaaatgaaaggtaccttcgtttgcttattttgtacat |
39365485 |
T |
|
| Q |
103 |
tttcatcttccttccaagcataaggtaatagtgatcatatgattttttgtatgtatttaaaggtgtggatgacattgaaatagacatgaagttgcaaaag |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39365484 |
tttcatcttccttccaagcataaggtaatagtgatcatatgattttttgtatttatttaaaggtgtggatgacattgaaatagacatgaagttgcaaaag |
39365385 |
T |
|
| Q |
203 |
gtgacggtgaatggttttgctgatcagaagaaggttctaaaaagggttcgaaaaactggacttagggctgagttatggcagcttc |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39365384 |
gtgacggtgaatggttttgctgatcagaagaaggttctaaaaagggttcgaaaaactggacttagggctgagttatggcagcttc |
39365300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University