View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3675_high_13 (Length: 298)
Name: NF3675_high_13
Description: NF3675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3675_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 7e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 812694 - 812432
Alignment:
| Q |
1 |
tttcacggtggcgctgtggcagtgattgttgtggtaaataaagttttgaagaatcc-aatatgcttcgatatgtaacacaaaaaagaaaataatatacct |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
812694 |
tttcacggtggcgctgtggcagtgattgttgtgttaaataaatttttgaagaatcccaatatgcttcgatatgtaacacataaaagaaaataatatacct |
812595 |
T |
 |
| Q |
100 |
tttgtagacatacaaattacattaca------atttgttgttgctaatggtaaaaacaatatcagaaactcatgcatgtat-tgaaatgaaatgagagag |
192 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
812594 |
tttgtagacatacaaattacattacaatttcaatttgttgttgctaatggtaaaaacaatatcagaaactcatgcatgtatctgaaatg--atgagagag |
812497 |
T |
 |
| Q |
193 |
agtcaagnnnnnnntaataagagtggaagaa-gaggatgggtattttctatgtcgttatttaatt |
256 |
Q |
| |
|
| ||||| ||||||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
812496 |
attcaagaaaaaaataataagagtggaagaagggggatgggtattttctatgtcgttatttaatt |
812432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University