View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3675_high_19 (Length: 238)
Name: NF3675_high_19
Description: NF3675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3675_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 18 - 145
Target Start/End: Complemental strand, 34148128 - 34147994
Alignment:
| Q |
18 |
gtaggctagttatggatatgaatgaattatggaatagctgtataattg-agtt------ctttctttctttcactttggttattgcttttcataaaatcc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34148128 |
gtaggctagttatggatatgaatgaattatggaatagctgtataattgtagttttttttctttctttctttcactttggttattgcttttcataaaatcc |
34148029 |
T |
 |
| Q |
111 |
ctatctcatgtaatttcaggaagtaatgtacaggt |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
34148028 |
ctatctcatgtaatttcaggaagtaatgtacaggt |
34147994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University