View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3675_low_22 (Length: 246)

Name: NF3675_low_22
Description: NF3675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3675_low_22
NF3675_low_22
[»] chr4 (1 HSPs)
chr4 (14-229)||(34147334-34147549)


Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 14 - 229
Target Start/End: Original strand, 34147334 - 34147549
Alignment:
14 agaacatggtggtttgcgagagtgagtcgttacctcatgagcgcaaattgtgtactatattatcactctttaaaagtaattttatggcctttaaagaaaa 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
34147334 agaacatggtggtttgcgagagtgagtcgttacctcatgagcgcaaattgtgtactatattatcactctttaaaagtaattttatggccttaaaagaaaa 34147433  T
114 tttaaatgtcatgtagttggaaaataaattctaaaattatcgttaaattaatatgaaaaatagatagtagttttttattaggggatgaaatagagatagt 213  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
34147434 tttaaatgtcatgtagttggaaaataaattctaaaattatcgttaaattattatgaaaaatagatagtagttttttattaggggatgaaatagagatagt 34147533  T
214 tgatatcttccataag 229  Q
    ||||||||||||||||    
34147534 tgatatcttccataag 34147549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University