View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3675_low_28 (Length: 224)
Name: NF3675_low_28
Description: NF3675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3675_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 48 - 206
Target Start/End: Complemental strand, 51845300 - 51845142
Alignment:
| Q |
48 |
tatcttgtccggatccatcgctaggtggtgacgttaaatccgaagaaggatcgcatgctttgtcaagtggcttcccacaaagctcttcatttcctgcaaa |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51845300 |
tatcttgtccggatccatcgctaggtggtgacgttaaatccgaagaaggatcgcatgctttgtcaagtggcttcccacaaagctcttcatttcctgcaaa |
51845201 |
T |
 |
| Q |
148 |
agattttgcctcatacttggacaagggaccaggtattgcaccttgtaacttgttgttag |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51845200 |
agattttgcctcatacttggacaagggaccaggtattgcaccttgtaacttgttgttag |
51845142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University