View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3676_high_16 (Length: 279)
Name: NF3676_high_16
Description: NF3676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3676_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 46748302 - 46748521
Alignment:
| Q |
1 |
agtggagaagcataggaagattttgtcccttacataggaaagtggcgttatgctggggctaccctttttggtggctgctgtaggaccactcccaaaacta |
100 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46748302 |
agtggggaagcagaggaagattttgtcccttacataggaaagtggcgttatgctggggctaccctttttggtggctgctgtaggaccactcccaaaacta |
46748401 |
T |
 |
| Q |
101 |
ttagaggcataaccgaggcattatatggaaagcctcatggcaaatgtgtataaaatgttgattgatgttgaagtatggtttatcttatgtgtgtaataat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
46748402 |
ttagaggcataaccgaggcattatatggaaaacctcatggcaaatgtatataaa----------ctgttgaagtatggtttatcttatgtgtgtaataat |
46748491 |
T |
 |
| Q |
201 |
taatgatggaacaaatgatcataacaataa |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
46748492 |
taatgatggaacaaatgatcataacaataa |
46748521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University