View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3676_high_27 (Length: 248)
Name: NF3676_high_27
Description: NF3676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3676_high_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 4 - 179
Target Start/End: Original strand, 3854101 - 3854276
Alignment:
| Q |
4 |
tgtgctggagccttcagatggccagtgatagtaaggtgtttacttgaattggatgcttgtgaaattcgctcagttcgctgctatcattatcaattttttc |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3854101 |
tgtgctggagccttcagatggccagtgatagtaaggtgtttacttgaattggatgcttgtgaaattcgctcagttcgctgctatcattatcaattttttc |
3854200 |
T |
 |
| Q |
104 |
tgccttcggactttgtaatagaggttggtcctctcaatatagagatgtgattttttctgaaatccttaacgtgatt |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
3854201 |
tgccttcggactttgtaatagaggttggtcctctcaatatagagatgtgatttttgctgaaatccttaatgtgatt |
3854276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 148 - 234
Target Start/End: Original strand, 3854269 - 3854355
Alignment:
| Q |
148 |
atgtgattttttctgaaatccttaacgtgattaatattgtatggtacagctgcaacctacagaggtttgatggtaaaaccatgtctt |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3854269 |
atgtgattttttctgaaatccttaacgtgattaatattgtatggtacagctgcaatctacagaggtttgatggtaaaaccatgtctt |
3854355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University