View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3676_high_30 (Length: 238)
Name: NF3676_high_30
Description: NF3676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3676_high_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 43 - 220
Target Start/End: Original strand, 25379139 - 25379316
Alignment:
| Q |
43 |
agcagtagtactgatgaacgctttttgagtagtcaaagttttgatatagtcttgaagaatagaagattgtggtttaccatcagtggtttgaggccttttg |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25379139 |
agcagtagtactgatgaacgctttttgagtagtcaaagttttgatatagtcttgaagaatagaagattgtggtttaccatcagtggtttgaggccttttg |
25379238 |
T |
 |
| Q |
143 |
ttctttctccttgaattttgtctcctttttgttgcattccaatgattctttattgcattctcagttcttccaggaatt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25379239 |
ttctttctccttgaattttgtctcctttttgttgcattccaatgattctttattgcattctcagttcttccaggaatt |
25379316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 25379064 - 25379115
Alignment:
| Q |
1 |
gtttgaagaagggtcctcagagatcgctgacacggagctagtagcagtagta |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25379064 |
gtttgaagaagggtcctcagagatcgctgacacggagctagtagcagtagta |
25379115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 140 - 219
Target Start/End: Original strand, 29671189 - 29671268
Alignment:
| Q |
140 |
ttgttctttctccttgaattttgtctcctttttgttgcattccaatgattctttattgcattctcagttcttccaggaat |
219 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| |||||||||||||| ||||| ||||| ||||||||||| ||||| |
|
|
| T |
29671189 |
ttgttctttcttcttgaattttgtcttctttttgtggcattccaatgattttttatggcattttcagttcttcctggaat |
29671268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 43866564 - 43866521
Alignment:
| Q |
170 |
tttgttgcattccaatgattctttattgcattctcagttcttcc |
213 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
43866564 |
tttgttgcattccaatggttttttattgcattctcagttcttcc |
43866521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University