View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3676_high_32 (Length: 228)
Name: NF3676_high_32
Description: NF3676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3676_high_32 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 15 - 209
Target Start/End: Original strand, 43725229 - 43725423
Alignment:
| Q |
15 |
atactcatcatcaacacaagaactactatagcctagaactaaatgcttcgttgaacccaggcataaccacaggaaccagcaatttcttagtacaaatagg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
43725229 |
atactcatcatcaacacaagaactactatagcttagacctaaatgcttcgttgaacccaggcataaccacaggaaccagcaatttcttagtacaaatcgg |
43725328 |
T |
|
| Q |
115 |
agttggaggaccaccacaaaaattctacatgattttcgacctccaaaccgatttcacctggcttcaatgccaaccatgtatcaaatgttacgatc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43725329 |
agttggaggaccaccacaaaaattctacatgattttcgacctccaaaccgatttcacttggcttcaatgccaaccatgtatcaaatgttacgatc |
43725423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University