View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3676_low_10 (Length: 315)
Name: NF3676_low_10
Description: NF3676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3676_low_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 48 - 300
Target Start/End: Complemental strand, 980489 - 980237
Alignment:
| Q |
48 |
aaaaccccggttaattggtttgaggacttgaactttccacttctaggctaaagttttaaatcacttgcccgaagatcaaaaatccgcagctgagtctagt |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
980489 |
aaaaccccggttaattggtttgaggacttgaactttccacttctaggctaaagttttaaatcacttgcccgaagatcaaaaatccgcagctgagtctagt |
980390 |
T |
 |
| Q |
148 |
gccttttcaacaatgtatgctaatccatatgatgcaattggaaaagtatttggacctgagcgctcgggtcgtgttcgaggtttgggaattgggatatccc |
247 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
980389 |
gccttttcaacaatgtatgctaatccatacgatgcaattggaaaagtatttggacctgagcgctcgggtcgtgttcgaggtttgggaattgggatatccc |
980290 |
T |
 |
| Q |
248 |
cttctagaaagttcggaccagatgtctgtttaaaggtattcgaccaagatttt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
980289 |
cttctagaaagttcggaccagatgtctgtttaaaggtattcgaccaagatttt |
980237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 18 - 226
Target Start/End: Complemental strand, 27146633 - 27146425
Alignment:
| Q |
18 |
gaaggagcttgactacttctannnnnnnnnaaaaccccggttaattggtttgaggacttgaactttccacttctaggctaaagttttaaatcacttgccc |
117 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27146633 |
gaaggagcttgactacttctaattttttttaaaaccccgtttaattggtttgaggacttgaactttccacttctaggctaaagttttaaatcacttgccc |
27146534 |
T |
 |
| Q |
118 |
gaagatcaaaaatccgcagctgagtctagtgccttttcaacaatgtatgctaatccatatgatgcaattggaaaagtatttggacctgagcgctcgggtc |
217 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27146533 |
gaagatcaaaaatccgcagttgagtctagtgccttttcaacaatgtatgctaatccatacgatgcaattggaaaagtatttggacctgagcgctcgggtc |
27146434 |
T |
 |
| Q |
218 |
gtgttcgag |
226 |
Q |
| |
|
||||||||| |
|
|
| T |
27146433 |
gtgttcgag |
27146425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University