View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3676_low_13 (Length: 292)
Name: NF3676_low_13
Description: NF3676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3676_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 99; Significance: 7e-49; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 180 - 282
Target Start/End: Original strand, 41046164 - 41046266
Alignment:
| Q |
180 |
gattcataactacatgaataggttttaagtttaagacgtgtcaactaaatggtaagagcttgaatttgtaacgtcaaagtatatggtttaaattccacct |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41046164 |
gattcataactacatgaataggttttaagtttaagacgtgtcaactaaatggtaagagcttgaatttataacgtcaaagtatatggtttaaattccacct |
41046263 |
T |
|
| Q |
280 |
atg |
282 |
Q |
| |
|
||| |
|
|
| T |
41046264 |
atg |
41046266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 17 - 110
Target Start/End: Original strand, 41046001 - 41046094
Alignment:
| Q |
17 |
aggatgtgcatgaattggagccttattgcttcagctgatctcaaaattaatttcattttattatgaggaaaaaatgttctgtagtttaggccac |
110 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41046001 |
aggatgtgcatgaattggagacttattgcttcagctgatctcaaaatcaatttcattttattatgaggaaaaaatgttctgtagtttaggccac |
41046094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University