View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3676_low_23 (Length: 267)
Name: NF3676_low_23
Description: NF3676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3676_low_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 13715596 - 13715843
Alignment:
| Q |
1 |
acaccctcttattcgtaactggtcattagttagaagcttatgatgagccaatctccaaacaaatgaaggcccgannnnnnnnnnnnnnnnatgtgggggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |||||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
13715596 |
acaccctcttattcgtaactggtcatcagttagaagcttttgatgagccaatctttaaacaaatgaaggcccgagtgtgtgtgtgtgt--atgtgggggg |
13715693 |
T |
|
| Q |
101 |
tggggacaaaggcatttcaaataaacttgcaccaactcaacttgattcgtattcagaaaatcataagctaacttgttggacaaatccccatccatagagt |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13715694 |
tggggacaaaggcattccaaataaacttgcaccaactcaacttgattcgtattcagaaaatcataagctaacttgttagacaaatccccatccatagagt |
13715793 |
T |
|
| Q |
201 |
gaagccaatgcaaacagtcattttgaggttcaatgcaaagagtcgtattt |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13715794 |
gaagccaatgcaaacagtcattttgaggttcaatgcaaagagtggtattt |
13715843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University