View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3677_high_3 (Length: 308)
Name: NF3677_high_3
Description: NF3677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3677_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 83 - 237
Target Start/End: Original strand, 32398514 - 32398666
Alignment:
| Q |
83 |
atctaaatagattatttgtatcacaaatgattaatctctgatttttggaagatatattgggcagcaaggaaattataacgtaaaggttatgatttattcc |
182 |
Q |
| |
|
|||||||||||||||| ||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |||| | |
|
|
| T |
32398514 |
atctaaatagattatt-gtatcttaaattattaatctctgatttttggaagatatattgggcagcaaggaaattataacgtgacggttatgatctatt-c |
32398611 |
T |
 |
| Q |
183 |
tttagtgttaaatttcaatttcataagtttattggtatgttaacctttatgcttt |
237 |
Q |
| |
|
||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32398612 |
tttggtgttaaatttcaatttcataagcttattggtatgttaacctttatgcttt |
32398666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 32397603 - 32397651
Alignment:
| Q |
1 |
aattacttttgaatactatttattgtcaaaattaaaaattatacataaa |
49 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||| |||||| |||||||| |
|
|
| T |
32397603 |
aattacttttggatactctttattgtcaaaatttaaaattgtacataaa |
32397651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University