View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3677_high_7 (Length: 244)
Name: NF3677_high_7
Description: NF3677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3677_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 17 - 218
Target Start/End: Original strand, 27027907 - 27028105
Alignment:
| Q |
17 |
attaatgttaagttagaaggagtagctgttgaaacctttgaggaaaactcaaacactgaatcagagataaattaatatggaagcatagtaataatgggga |
116 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27027907 |
attaatgttaagctagaaggagtagctgctgaaacctttgaggaaaactcaaacactgcatcagagataaattaatatggaagcatagtaataatgggga |
27028006 |
T |
 |
| Q |
117 |
gttaactctgaaaggtgcttatgatttcaagaaaaatcccctaaaatggaatgggctaattagctaatttgggctcctgatttccctccctcaaaatctt |
216 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27028007 |
gttaaatctgtaaggtgcttatgatttcaagaaaaatcccctaaaatgaaatgggcta---agctaatttggtctcctgatttccctccctcaaaatctt |
27028103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University