View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3677_low_8 (Length: 289)
Name: NF3677_low_8
Description: NF3677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3677_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 7e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 62 - 262
Target Start/End: Complemental strand, 13375919 - 13375718
Alignment:
| Q |
62 |
taccccacatcttgtttgtttgtttatttttcttggagccgatccgtgtacattacaatagtatacttttttctcccagaaagaataaaaataatttaac |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13375919 |
taccccacatcttgtttgtttgtttatttttcttggagccgatccgtgtacattacaatagtatacttttttctcccagaaagaataaaaataatttaac |
13375820 |
T |
 |
| Q |
162 |
ttcac-nnnnnnngaaggacaattaacttcacttgaaattgtctaaaaaagtttgtttcgcattcacaaaaagatgagaaatgatatttggatgagtatt |
260 |
Q |
| |
|
| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
13375819 |
tacacttttttttgaaggacaattaacttcacttgaaattgtctaaaaaagtttgtttcgcatccataaaaagatgagaaatgatatttggatgagtatt |
13375720 |
T |
 |
| Q |
261 |
at |
262 |
Q |
| |
|
|| |
|
|
| T |
13375719 |
at |
13375718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University