View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3678_high_31 (Length: 307)
Name: NF3678_high_31
Description: NF3678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3678_high_31 |
 |  |
|
| [»] scaffold0332 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0332 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: scaffold0332
Description:
Target: scaffold0332; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 4 - 296
Target Start/End: Original strand, 5165 - 5457
Alignment:
| Q |
4 |
agcaaagggaggatgtcagggaacggaatattgagtgtacttatactgcttgcgttgcagtcgctggtcggaggtgattacatcccaccgaagaaatacg |
103 |
Q |
| |
|
||||||| || |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5165 |
agcaaagagaagatgtcagggaaaggaatattgagtgtacttatactgcttgcgttgcagtcgctggtcggaggtgattacatcccaccgaagaaatacg |
5264 |
T |
 |
| Q |
104 |
acggattcgtttacaagaatcgtcatcacttgagttacgatactattcagatcgaagctttctatgatcctttatgccctgacagcgctgattcatggcc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5265 |
acggattcgtttacaagaatcgtcatcacttgagttacgatactattcagatcgaagctttctatgatcctttatgccctgacagcgctgattcatggcc |
5364 |
T |
 |
| Q |
204 |
acctctcaaaaaagctcttcatcactactcctctcgtgtttccttcgttgttcatcttcttcctctaccgttcgttctctaatcccttccttt |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5365 |
acctctcaaaaaagctcttcatcactactcctctcgtgtttccttcgttgttcatcttcttcctctaccgttcgttctctaatcccttccttt |
5457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University