View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3678_high_47 (Length: 218)
Name: NF3678_high_47
Description: NF3678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3678_high_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 12 - 167
Target Start/End: Complemental strand, 45744658 - 45744503
Alignment:
| Q |
12 |
aacctgtgtcattgtgtttgggtttaacaatttttgcatttttagggt-aggacttgtggactacatatggagatattttttgtttcggtacaaggacta |
110 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||| ||| ||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45744658 |
aacccgtgtcattgtgtttgggtt-aacaatttttgcatttttacggttaggacttatggactacatatgaagatattttttgtttcggtacaaggacta |
45744560 |
T |
 |
| Q |
111 |
caaagattctaattgttacacttaaataaaatgatgcttaaattacgactagatttc |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45744559 |
tgaagattctaattgttacacttaaataaaatgatgcttaaattacgactagatttc |
45744503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University