View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3678_low_23 (Length: 372)
Name: NF3678_low_23
Description: NF3678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3678_low_23 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 2e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 20 - 226
Target Start/End: Complemental strand, 9637007 - 9636802
Alignment:
| Q |
20 |
tctaggagatacaaacataaaactaaaggtgggcgaaaatgctcatacatgagatacaagagagatgatcatacttgaaaacttaaaaatattgtataga |
119 |
Q |
| |
|
|||||||| |||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9637007 |
tctaggaggtacaaacataaat-taaagatgggcgaaaatgctcatacatgagatacaagagagatgatcatacttgaaaacttaaaaatattgtataga |
9636909 |
T |
 |
| Q |
120 |
tgatattgattgtgtagccaatagttcaacaaaaacaagtctttgaggtaacgttggagagcatatggaaacacaagaacaataaggtctggaacaacac |
219 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9636908 |
tgatattgattgtgtagccaatagtttaacaaaaacaagtctttgaggtaacgttggagagcatatggaaacacaagaacaataaggtctggaaaaacac |
9636809 |
T |
 |
| Q |
220 |
aattgaa |
226 |
Q |
| |
|
||||||| |
|
|
| T |
9636808 |
aattgaa |
9636802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University