View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3679_high_12 (Length: 250)
Name: NF3679_high_12
Description: NF3679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3679_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 8e-73; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 104 - 246
Target Start/End: Original strand, 38341522 - 38341664
Alignment:
| Q |
104 |
agccactgatttcttctttgaactcgtcgatgctcttttcttattgaatgaataatccacttcgtcctcatcatcgttttcttcaagtacatctccatca |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38341522 |
agccactgatttcttctttgaactcgtcgatgctcttttcatattgaatgaataatccacttcgtcctcatcatcgttttcttcaagtacatctccatca |
38341621 |
T |
 |
| Q |
204 |
aactcataaggagggtcgaggacatcatcaacctcaacagcct |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38341622 |
aactcataaggagggtcgaggacatcatcaacctcaacagcct |
38341664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 104 - 247
Target Start/End: Original strand, 38333769 - 38333912
Alignment:
| Q |
104 |
agccactgatttcttctttgaactcgtcgatgctcttttcttattgaatgaataatccacttcgtcctcatcatcgttttcttcaagtacatctccatca |
203 |
Q |
| |
|
|||||||||||||||||||||||| || ||||| ||| |||| ||| ||||||||||||| ||||| ||||| || |||||||||||| ||||||||||| |
|
|
| T |
38333769 |
agccactgatttcttctttgaacttgttgatgcgcttgtcttcttggatgaataatccacgtcgtcatcatcgtcattttcttcaagttcatctccatca |
38333868 |
T |
 |
| Q |
204 |
aactcataaggagggtcgaggacatcatcaacctcaacagcctc |
247 |
Q |
| |
|
| |||||||||||||||||||||||||| | | ||||||||| |
|
|
| T |
38333869 |
ataacataaggagggtcgaggacatcatcaccgttaacagcctc |
38333912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 9 - 70
Target Start/End: Original strand, 38341427 - 38341488
Alignment:
| Q |
9 |
gagatgaatgcgggaactttttaggaggttcttcagtacccttttctaaatcatcattagcc |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38341427 |
gagatgaatgcgggaactttttaggaggttcttcagtacccttttctaaatcatcattagcc |
38341488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 9 - 70
Target Start/End: Original strand, 38333675 - 38333736
Alignment:
| Q |
9 |
gagatgaatgcgggaactttttaggaggttcttcagtacccttttctaaatcatcattagcc |
70 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
38333675 |
gagatgcatgggggaactttttaggaggttcttcagtaaccttttctgaatcatcattagcc |
38333736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 112 - 189
Target Start/End: Complemental strand, 25379419 - 25379342
Alignment:
| Q |
112 |
atttcttctttgaactcgtcgatgctcttttcttattgaatgaataatccacttcgtcctcatcatcgttttcttcaa |
189 |
Q |
| |
|
||||||| |||||| | || ||||||||||||| || |||||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
25379419 |
atttcttttttgaatttgttaatgctcttttcttcttagatgaattatccacttcgtcctcgtcatcattttcttcaa |
25379342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University