View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3680_high_16 (Length: 291)
Name: NF3680_high_16
Description: NF3680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3680_high_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 274
Target Start/End: Original strand, 42088811 - 42089084
Alignment:
| Q |
1 |
atttcacttctctcctttctttaagcatcatcatcctcaaggttttgcagtgcagaaggatccttcagacacagcgatcgacccacgttatggggttgag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42088811 |
atttcacttctctcctttctttaagcatcttcatcctcaaggttttgcagtgcagaaggatccttcagacacagcgatcgatccacgttatggggttgag |
42088910 |
T |
|
| Q |
101 |
aagcgccgtgtgcctactggtccaaacccgttacaccattgattgaattctcgatttattttgtctaaaccctctggttctcagggaaatgaggtcctgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||| ||| |
|
|
| T |
42088911 |
aagcgccgtgtgcctactggtccaaacccgttacaccattgattgaattctcgatttattttgtcttaaccctctggttctcaggaaaatgaggtcatgc |
42089010 |
T |
|
| Q |
201 |
ttggtaacacgatgctatactcaattaatatattttttgttctggtaactttctcttattgatctccatcattg |
274 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| ||||||||||| |||| |
|
|
| T |
42089011 |
ttggtaacacgatgctatactaaattaatatattttttgttctgttaactttctctttttgatctccattattg |
42089084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University