View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3680_high_19 (Length: 246)
Name: NF3680_high_19
Description: NF3680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3680_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 11 - 230
Target Start/End: Complemental strand, 25026729 - 25026494
Alignment:
| Q |
11 |
cagagactttcattgaaccaggaccatattagaggcttcgtacattattaatttattaataaaacataaga----------------ggatactcatgtg |
94 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||| |||||||||||||||||||| |||||||||| | ||||||||||| |
|
|
| T |
25026729 |
cagagactttcattgaaccaagactatattagaggcttcatacattattaatttattaatgaaacataagaatgaaagaaagaaagagcatactcatgtg |
25026630 |
T |
 |
| Q |
95 |
aagtaggatattatcatgtgaagtgggattcttaatttgtttaacacatgaagttggtactaaaatgtcttgttattttgaaacatcaggtggatatgga |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25026629 |
aagtaggatattatcatgtgaagtgggattcttaatttgtttaacacatgaagttggtactaaaatgtcttgttattttgaaacatcaggtggatatgga |
25026530 |
T |
 |
| Q |
195 |
acccttgaagaattgctggaaattattacttgggct |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
25026529 |
acccttgaagaattgctggaaattattacttgggct |
25026494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University